Login | Register

Info | Home

BioPHP - Microsatellite Repeats Finder

Original code submitted by joseba
Code bellow is covered by GNU GPL v2 license.

Description

Last change: 2006/11/20 17:03 | Edit description | Recent Changes | Original description
Finds microsatellites in DNA sequences. Microsatellites are copies of
simple di, tri, tetra, and pentanucleotides which lie adjacent to each
other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite
repeat of tetranucleotide ACGT.

Code

Last change: 2008/03/17 17:49 | Edit Code | Recent Changes | Download | Original code and
<!--
Title: Microsatellites Script
Author: Joseba Bikandi
-->

<html><head>
<title>Find tandem repeats</title>
</head>
<body bgcolor=FFFFFF>

<h1>Microsatellite repeats finder</h1>

<form method="POST" action=""<? print $_SERVER["PHP_SELF"]; ?>"">
<b>Sequence</b>:<br>
<TEXTAREA name=sequence cols="75" rows="10">AACAATGCCATGATGATGATTATTACGACACAACAACACCGCGCTTGACGGCGGCGGATGGATGCCG
CGATCAGACGTTCAACGCCCACGTAACGTAACGCAACGTAACCTAACGACACTGTTAACGGTACGAT
</TEXTAREA>
<br>Length of repeated sequence: Minimum:<select name=min><option selected>2<option>3<option>4<option>5<option>6</select>
&nbsp; Maximum:<select name=max><option>3<option>4<option>5<option selected>6<option>7<option>8<option>9<option>10</select>
<br>Minimum number of repeats: <select name=min_repeats><option>2<option selected>3<option>4<option>5<option>6</select>
<br>Minimum length of tanden repeat: <select name=length_of_MR><option>5<option>6<option>7<option>8<option>9<option selected>10<option>11<option>12<option>13<option>14<option>15<option>16<option>17<option>18<option>19<option>20</select></select></select>
<br>Allowed percentaje of mismatches: <select name=mismatch><option selected>0<option>0.1<option>0.2<option>0.3</select>
<br><input type=submit value="Find Microsatellite repeats">
</form>
<p>
<?php
// IF NO DATA POSTED, DIE
if($_POST){
    // Get the sequence
    $sequence=strtoupper($_POST["sequence"]);
        // Remove non word and digits from sequence
        $sequence=preg_replace("/\W|\d/","",$sequence);

    // Get paramethers
    $min_length=$_POST["min"];
    $max_length=$_POST["max"];
    $min_repeats=$_POST["min_repeats"];
    $min_length_of_MR=$_POST["length_of_MR"];
    $mismatches_allowed=$_POST["mismatch"];


    //Find microsatellite repeats (uses a function)
    $results=find_microsatellite_repeats ($sequence,$min_length,$max_length,$min_repeats,$min_length_of_MR,$mismatches_allowed);


    // Print results
    print "<table cellpadding=4>";
    print "<tr><td bgcolor=AAAAAFF>Posici&oacute;n</td><td bgcolor=AAAAAFF>Cicle</td><td bgcolor=AAAAAFF>Repeats</td><td bgcolor=AAAAAFF>Sequence</td></tr>\n";
    foreach ($results as $key => $val){
        print "<tr>";
        print "<td>".$results[$key]["start_position"]."</td>";
        print "<td>".$results[$key]["length"]."</td>";
        print "<td>".$results[$key]["repeats"]."</td>";
        print "<td>".$results[$key]["sequence"]."</td>\n";
        print "</tr>";
    }
    print "</table>";
}    

// Description for Function find_microsatellite_repeats
//      This function will search for microsatellite repeats within a sequence. A microsatellite repeat is defined as a sequence
//      which shows a repeated pattern, as for example in sequence 'ACGTACGTACGTACGT', where 'ACGT' is repeated
//      4 times. The function allows searching for this kind of subsequences within a sequence.
//
// Parameters
//      $sequence is the sequence
//      $min_length and $max_length are the range of oligo lengths to be searched; p.e. oligos with length 2 to 6
//      $min_repeats is the minimal number of time a sequence must be repeated to be considered as a microsatellite repeat
//      $min_length_of_MR  minimum length of tanden repeat; to avoid considering AAAA as a microsatellite repeat, set it to >4
//      $mismatches_allowed is the porcentaje of errors allowed when searching in the repetitive sequence
//         so that sequence AACCGGTT-AAGCGGTT-AACCGGAT-AACCGGTT may be considered as a microsatellite repeat
//
// Return
//      The function will return an array with the following structure:
//      $results=Array(
//             0=>Array(
//                    start_position => 10,
//                    length => 4,
//                    repeats => 4,
//                    sequence => ACGTACGTACGTACGT,
//                     ),
//             0=>Array(
//                    start_position => 50,
//                    length => 3,
//                    repeats => 3,
//                    sequence => ATCATCATC,
//                     ),
//      );
//
// Requeriments:
//      Functions IncludeN_1, IncludeN_2 and IncludeN_3
function find_microsatellite_repeats($sequence,$min_length,$max_length,$min_repeats,$min_length_of_MR,$mismatches_allowed){
        $len_seq=strlen($sequence);
        $counter=0;
        for ($i=0;$i<$len_seq-3;$i++){
                for ($j=$min_length;$j<$max_length+1;$j++){
                        if (($i+$j)>$len_seq){break;}
                        $sub_seq=substr($sequence,$i,$j);
                        $len_sub_seq=strlen ($sub_seq);
                        $mismatches=floor($len_sub_seq*$mismatches_allowed);
                        if ($mismatches==1){$sub_seq_pattern=includeN_1($sub_seq,0);}
                        elseif ($mismatches==2){$sub_seq_pattern=includeN_2($sub_seq,0);}
                        elseif ($mismatches==3){$sub_seq_pattern=includeN_3($sub_seq,0);}
                        else {$sub_seq_pattern=$sub_seq;}

                        $matches=1;
                        while (preg_match_all("/($sub_seq_pattern)/",substr($sequence,($i+$j*$matches),$j),$out)==1){$matches++;}

                        if ($matches>=$min_repeats and ($j*$matches)>=$min_length_of_MR){
                                $results[$counter]["start_position"]=$i;
                                $results[$counter]["length"]=$j;
                                $results[$counter]["repeats"]=$matches;
                                $results[$counter]["sequence"]=substr($sequence,$i,$j*$matches);
                                $counter++;
                                $i+=$j*$matches;
                                }
                }
        }
        return ($results);
}

// Description for Function IncludeN_1
//      When a DNA sequence ("$primer") is provided to this function, as for example "acgt", this function will return
//      a pattern like ".cgt|a.gt|ac.t|acg.". This pattern may be useful to find within a DNA sequence
//      subsequences matching $primer, but allowing one missmach. The parameter $minus
//      is a numeric value which indicates number of bases always maching  the DNA sequence in 3' end.
//      For example, when $minus is 1, the pattern for "acgt" will be  ".cgt|a.gt|ac.t".
//      Check also IncludeN_2 and IncludeN_3.
//
// Parameters
//      $primer is a DNA sequence (oligonucleotide, primer)
//      $minus indicates number of bases in 3' which will always much the DNA sequence.
//
// Return
//      Returns a pattern (as described in "Description").

function includeN_1($primer,$minus) {
        $code=".".substr($primer,1);
        $wpos=1;
        while ($wpos<strlen($primer)-$minus){
        $code.="|".substr($primer,0,$wpos).".".substr($primer,$wpos+1);
        $wpos++;
        }
return ($code);
}

// Description for Function IncludeN_2
//      Similar to function IncludeN_1. When a DNA sequence ("$primer") is provided to this function, as for example "acgt",
//      this function will return a pattern like "..gt|.c.t|.cg.|a..t|a.g.|ac..". This pattern may be useful to find within
//      a DNA sequence subsequences matching $primer, but allowing two missmaches. The parameter $minus
//      is a numeric value which indicates number of bases always maching  the DNA sequence in 3' end.
//      For example, when $minus is 1, the pattern for "acgt" will be  "..gt|.c.t|a..t".
//      Check also IncludeN_1 and IncludeN_3.
//
// Parameters
//      $primer is a DNA sequence (oligonucleotide, primer)
//      $minus indicates number of bases in 3' which will always much the DNA sequence.
//
// Return
//      Returns a pattern (as described in "Description").
function includeN_2($primer,$minus) {
        $max=strlen($primer)-$minus;
        $code="";
        for($i=0;$i<$max;$i++){
                for($j=0;$j<$max-$i-1;$j++){
                  $code.="|".substr($primer,0,$i).".";
                  $resto=substr($primer,$i+1);
                  $code.=substr($resto,0,$j).".".substr($resto,$j+1);
                }
                }

$code=substr($code,1);
return ($code);
}

// Description for Function IncludeN_3
//      Similar to function IncludeN_1 and IncludeN_2, but allows two missmaches. The parameter $minus
//      is a numeric value which indicates number of bases always maching  the DNA sequence in 3' end.
//
// Parameters

//      $primer is a DNA sequence (oligonucleotide, primer)
//      $minus indicates number of bases in 3' which will always much the DNA sequence.
//
// Return
//      Returns a pattern (as described in "Description").
function includeN_3($primer,$minus) {
        $max=strlen($primer)-$minus;
        $code="";
        for($i=0;$i<$max;$i++){
                for($j=0;$j<$max-$i-1;$j++){
                  $code.="|".substr($primer,0,$i).".";
                  $resto=substr($primer,$i+1);
                  $code.=substr($resto,0,$j).".".substr($resto,$j+1);
                }
                }
$code=substr($code,1);
return ($code);
}
?>

<hr>
<font size=+1><b><u>Definitions</u></b></font>
<br><b>Microsatellite Repeat</b>:
<br>A variety of simple di- (DINUCLEOTIDE REPEATS), tri- (TRINUCLEOTIDE REPEATS), tetra-, and pentanucleotide tandem repeats (usually less than 100 bases long).
<p><b>Tandem repeats</b>:
<br>Copies of DNA sequences which lie adjacent to each other
<hr>
<b>NOTE</b>: for sort repeated sequences (p.e. AA or AAA), no mismatches are available.


</body>
</html>