Info | Home

BioPHP - Microsatellite Repeats Finder (original)

Original code submitted by joseba
Code bellow is covered by GNU GPL v2 license.


Last change: 2012/04/26 11:12 | Recent Changes
Finds microsatellites in DNA sequences. Microsatellites are copies of
simple di, tri, tetra, and pentanucleotides which lie adjacent to each
other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite
repeat of tetranucleotide ACGT.


Last change: 2012/04/26 11:12 | Download original | Recent Changes | Original code