Info | Home

BioPHP - Functions

BioPHP - Minitools

demo Chaos Game Representation of DNA
Graphical representation of genomes by Chaos Game Representation (CGR) as described by Jeffrey (1990), which represents DNA primary sequence organization, and Chaos Game Representation of Frequencies (FCGR), as described by Deschavanne at al. (1999), which represents frequency of oligonucleotides. demo Oligonucleotide frequency based distance among sequences
Compare sequences based in their oligonucleotide frecuencies. Two alternative methods may be used to compute distances: Eucldean distance for oligonucleotides 2 to 6 bases long, or pearson distance for z-scores of tetranucleotides. A table with distances and clustering results, including a dendrogram (UPGMA clustering), are shown. demo DNA to protein translation
Translated DNA sequence to protein by using all genetic codes, including customised ones. All frames are translated. demo Palindromic sequences finder
Will search the sequence to find palindromic subsequences. Allows selection of minimum and maximum size of palindromic subsequences. GC Contenf Finder
The Percentage of Guanine-Cytosine in a Nucleotide sequence determines the stability of the sequence.The GC Content Finder Helps to find out the stability of Nucleotide sequence demo Melting Temperature (Tm) Calculation
This tool will calculate melting temperature for an oligonucleotide. Formulas for basic tm calculation are explained in the script. For Base-Stacking Tm computing, references are provided. demo Microarray Data Analysis (adaptive quantification method)
Uses adaptative quantification method to analyse microarray results. Computational procedure is shown in the script. Results are shown in a table. demo Microsatellite repeats finder
Finds microsatellites in DNA sequences. Microsatellites are copies of simple di, tri, tetra, and pentanucleotides which lie adjacent to each other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite repeat of tetranucleotide ACGT. demo Frequency of nucleotides and oligonucleotides
This minitool will count number of ocurrences of each oligonucleotide with length between 1 and 8 within sequence. Counting may be performed in one or in both strands. demo PCR amplification
Simulation of PCR amplification. Allows one mismatch between primer and template custom essays demo Protein sequence properties
The following may be computed: Aminoacid composition, Molecular weight, Molar absorption coefficient, Protein isoelectric point and Charge. It also allows geting a colored sequence based in nature of each aminoacid. demo Protein to DNA reverse translation
Enter a protein sequence and obtain its reverse translation. Useful in design of degenerate oligonucleotides. All genetic codes are available. demo Random sequences
A tool to generate random DNA or protein sequences. It allows to shuffle a sequence, generate a random sequence by using frequencies in a sample sequences, or to generate random sequences by providing frequencies of nucleotides or aminoacids. Reader
This minitool reads fasta and gff files and instantiate sequence objects. demo Reduced alphabets for proteins
Displays aminoacids by grouping them in classes, so that reduced alphabets are generated. In the coloured sequence, grouped aminoacids will show the same colour. Reduced protein sequence may be also displayed. Additionally, each aminoacid may be displayed with a distinct colour (without applying reductions). demo Restriction enzyme digest of DNA
Restriction digestion of DNA sequences with endonucleases. Allows restriction of one or more sequences, and also the comparison of restriction patterns. All commercially available restriction enzymes are included in the script. demo Alignment of two DNA, RNA or protein sequences
Alignment of two DNA, RNA or protein sequences. The alignment method is the Smith-Waterman alignment method is used. More info in the script. demo DNA sequence manipulation/properties
The sequence is manipulate to remove non-coding characters, to get reverse and complement strands, to obtain both strands, to calculate G+C content and nucleotide composition, or may be converted to RNA. demo GC-, AT-, KETO- and oligo-skews generator
Genomes and sequences are not a random sequence of bases, and GC-, AT-, KETO- and oligo-skews allows to visualize the non-constant distribution of nucleotides and oligonucleotides in long sequences. demo Formula functions
A set of functions for useful formulas. There separate set of formulas categorized for DNA, RNA and Quantification of Proteins.