Info | Home
BioPHP - Functions
BioPHP - Minitools
Chaos Game Representation of DNA
Graphical representation of genomes by Chaos Game Representation (CGR) as
described by Jeffrey (1990), which represents DNA primary sequence
organization, and Chaos Game Representation of Frequencies (FCGR), as
described by Deschavanne at al. (1999), which represents frequency of
oligonucleotides.
Oligonucleotide frequency based distance among sequences
Compare sequences based in their oligonucleotide frecuencies. Two
alternative methods may be used to compute distances: Eucldean distance
for oligonucleotides 2 to 6 bases long, or pearson distance for z-scores
of tetranucleotides. A table with distances and clustering results,
including a dendrogram (UPGMA clustering), are shown.
DNA to protein translation
Translated DNA sequence to protein by using all genetic codes,
including customised ones. All frames are translated.
Palindromic sequences finder
Will search the sequence to find palindromic subsequences. Allows selection
of minimum and maximum size of palindromic subsequences.
GC Contenf Finder
The Percentage of Guanine-Cytosine in a Nucleotide sequence determines the
stability of the sequence.The GC Content Finder Helps to find out the stability of Nucleotide sequence
Melting Temperature (Tm) Calculation
This tool will calculate melting temperature for an oligonucleotide.
Formulas for basic tm calculation are explained in the script.
For Base-Stacking Tm computing, references are provided.
Microarray Data Analysis (adaptive quantification method)
Uses adaptative quantification method to analyse microarray results.
Computational procedure is shown in the script.
Results are shown in a table.
Microsatellite repeats finder
Finds microsatellites in DNA sequences. Microsatellites are copies of
simple di, tri, tetra, and pentanucleotides which lie adjacent to each
other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite
repeat of tetranucleotide ACGT.
Frequency of nucleotides and oligonucleotides
This minitool will count number of ocurrences of each oligonucleotide with
length between 1 and 8 within sequence. Counting may be performed in one
or in both strands.
PCR amplification
Simulation of PCR amplification. Allows one mismatch between primer and
template custom essays
Protein sequence properties
The following may be computed: Aminoacid composition, Molecular weight,
Molar absorption coefficient, Protein isoelectric point and Charge. It
also allows geting a colored sequence based in nature of each aminoacid.
Protein to DNA reverse translation
Enter a protein sequence and obtain its reverse translation. Useful in
design of degenerate oligonucleotides. All genetic codes are available.
Random sequences
A tool to generate random DNA or protein sequences. It allows to shuffle a
sequence, generate a random sequence by using frequencies in a sample
sequences, or to generate random sequences by providing frequencies of
nucleotides or aminoacids.
Reader
This minitool reads fasta and gff files and instantiate sequence objects.
Reduced alphabets for proteins
Displays aminoacids by grouping them in classes, so that reduced alphabets
are generated. In the coloured sequence, grouped aminoacids will show the
same colour. Reduced protein sequence may be also displayed.
Additionally, each aminoacid may be displayed with a distinct colour
(without applying reductions).
Restriction enzyme digest of DNA
Restriction digestion of DNA sequences with endonucleases. Allows
restriction of one or more sequences, and also the comparison of
restriction patterns. All commercially available restriction enzymes are
included in the script.
Alignment of two DNA, RNA or protein sequences
Alignment of two DNA, RNA or protein sequences. The alignment method is the
Smith-Waterman alignment method is used. More info in the script.
DNA sequence manipulation/properties
The sequence is manipulate to remove non-coding characters, to get reverse
and complement strands, to obtain both strands, to calculate G+C
content and nucleotide composition, or may be converted to RNA.
GC-, AT-, KETO- and oligo-skews generator
Genomes and sequences are not a random sequence of bases, and GC-, AT-,
KETO- and oligo-skews allows to visualize the non-constant distribution of
nucleotides and oligonucleotides in long sequences.
Formula functions
A set of functions for useful formulas. There separate set of formulas
categorized for DNA, RNA and Quantification of Proteins.