Info | Home

BioPHP - Functions

BioPHP - Functions


alignment_of_dna
Alignment of two DNA sequences. Smith-Waterman alignment method is used. alignment_of_proteins
Alignment of two protein sequences. Smith-Waterman alignment method is used. basic_tm
Basic melting (Tm) temperature foroligonucleotides chemgrp_protein
Translates peptide sequence to checmical groups. Chemical groups/aminoacids: L/GAVLI H/ST M/NQ R/FYW S/CM I/P A/DE C/KRH */* X/X complement
Gets the genetic complement of a DNA or RNA sequence. count_codons_dna_or_rna
Counts the number of codons (trios of base-pairs) in a DNA/RNA sequence. dna_is_palindrome
This is my proposal to substitute is_palindrome function from GenePHP. I have just tried to make it simple. By using function RevComp_DNA2 it allows searching within sequences with degenerated nucleotides Although its length is not odd, a pattern like TATANTATA will be considered palindromic Uses function RevComp_DNA2 dna_remove_non_coding
Removes non coding characters from DNA sequence. Degenerated nucleotides are not removed. dna_to_protein
Translates DNA to protein by using one of the 13 genetic codes described. expand_na
Returns the expansion of a nucleic acid sequence, replacing special wildcard symbols with the proper PERL regular expression. find_palindromic_seqs
Searches for palindromic sequences within a DNA sequence. Length of palindromic sequences to be searched will be between $min and $max values Will return an array with key = start position and val= palindromic sequence Requires function DNA_is_palindrome find_tandem_repeats
Searches for tandem repeats within a DNA sequence. A tandem repeat is a sequence with contains a pattern repeated several times as for example in AAAAAgtagtagtagtagtagtagtTTTTTTTTT, which contains a tandem repeat (subsequence GTA repeated 6 times). Tandem repeats may suffer insertions and deletions afecting the number of times the pattern is repeated. When amplifying by PCR the tandem repeat and the sequence around them, different strains will probably yield bands with different lengths. Comparison of patterns allows their usage for epidemiology porpoises $sequence is the DNA sequence to be searched $min_length is the minimum length of repeated pattern (must be >2) $max_length is the maximum length of repeated pattern $min_repeats is the minimum number of times the pattern must be repeated $min_length_of_TR is the minimum length of the tandem repeat Example: find_tandem_repeats(\"AAAAAgtagtagtagtagtagtagtTTTTTTTTT\",2,6,3,15) Result: Array( [0] => Array( [start_position] => 5 [pattern] => gta [number_of_repeats] => 6 [tandem_repeat_sequence] => gtagtagtagtagtagtagt )) This function does not allow errors within repeated pattern (with are detected by programs specificaly designed to search for tandem repeat) gc_content
Computes G+C content of DNA sequence get_bridge
Returns the sequence located between two palindromic halves of a palindromic string. Take note that the \"bridge\" as I call it, is not necessarily a genetic mirror or a palindrome. get_oligos_from_pattern
Will response with sequences recognized by a oligo pattern. If oligo does not include degenerate nucleotides response will be the same oligo example: oligo is TATA, and response will be TATA If oligo includes degenerate nucleotides response will be comma separated sequences example: oligo is WATW, and response will be AATA,AATT,TATA,TATT halfstr
Returns one of the two palindromic \"halves\" of a palindromic string. hglzfbsxdcyehoonix
5pdRHZ yrzbbehulpcl, [url=http://eqntasfbzzxg.com/]eqntasfbzzxg[/url], [link=http://eqvfzjbqxctb.com/]eqvfzjbqxctb[/link], http://lcmagduadnrd.com/ identify_aminoacid
Returns complete name of aminoacid. Input may be one or three letter code. molwt_nucleic_acid
Calculates the molecular weight of a nucleic acid. From GenePHP, seq.php, class seq molwt_protein
Computes the molecular weight of a protein sequence. nucleotide_composition
Calculates nucleotide composition of sequences. nucleotide_identification
Returns name of nucleotide. P.e., for A, returns \"Adenosine\". Degenerated nucleotides are also identified. P.e., for R, returns \"Purine (A & G)\" number_of_matching_sequences
Will response with number of sequences matching a oligo. If oligo does not include degenerate nucleotides response will be 1. example: oligo is TATA, and response will be 1 If oligo includes degenerated nucleotides response will be >1 . example: oligo is WATW, and response will be 4 (recognizes: AATA,AATT,TATA,TATT protein_to_dna
Reverse translation of protein to DNA by using one fo the 13 genomic codes described. random_dna
Generates a random DNA sequence. Number of A, C, G and T must be provided. revcomp
First gets the complement of a DNA or RNA sequence, and then returns it in reverse order. Uses the function complement revcomp_dna
Returns Reverse-Complement of DNA sequence. It is similar to revcomp function in GenePHP (in etc.php file), but the speed is about 6x faster. revcomp_dna2
This function is derived from RevComp_DNA function. I think it may be interesting to maintaing RevComp_DNA and RevComp_DNA2 as two separated functions; for big sequences, the functions may be selected depending on needs. This function allows transforming the sequence when degenerated nucleotides are present. salt_adjusted_tm
Salt_Adjusted Melting Temperature (Tm) Calculations $salt: monovalent cations concentration([K+] + [Na+]), mM seq_to_pattern_with_uib
Transforms a DNA sequence into a pattern Example: from RCGY to [AG]CG[CT] seqlen
Returns the length of a sequence stats_factorial
Computes factorial of number stats_mean
Will calculate the mean of a serie of numbers. stats_regression_correlation
Computes standard curve (y=ax+b) and correlation coefficient (r). stats_standard_deviation
Calculates Standard Deviation of a serie of numbers stats_variance
Calculates varience of a serie of numbers subseq
Return subsequence of sequence based in start and length of subsequence translate_codon
Translate a codon to correspondin aminoacid. If $format=3, a three letter aminoacid named is obtained. If $format=1, a one letter aminoacid named is obtained