Info | Home

BioPHP - Functions

BioPHP - Minitools
demo 
Graphical representation of genomes by Chaos Game Representation (CGR) as
described by Jeffrey (1990), which represents DNA primary sequence
organization, and Chaos Game Representation of Frequencies (FCGR), as
described by Deschavanne at al. (1999), which represents frequency of
oligonucleotides.


demo Oligonucleotide frequency based distance among sequences

Compare sequences based in their oligonucleotide frecuencies (for 2-6 bases
long oligos), get global distance (by computing a modified Pearson
correlation), and apply UPGMA clustering to results. A table with
distances and clustering results, including a dendrogram, are shown. 


demo DNA to protein translation

Translated DNA sequence to protein by using all genetic codes,
including customised ones. All frames are translated.





demo Palindromic sequences finder

Will search the sequence to find palindromic subsequences. Allows selection
of minimum and maximum size of palindromic subsequences.

GC Contenf Finder
The Percentage of Guanine-Cytosine in a Nucleotide sequence determines the
stability of the sequence


demo Melting Temperature (Tm) Calculation

This tool will calculate melting temperature for an oligonucleotide.
Formulas are explained in the script. 

demo Microarray Data Analysis (adaptive quantification method)

Uses adaptative quantification method to analyse microarray results.
Computational procedure is shown in the script.
Results are shown in a table.

Microsatellite repeats finder

Finds microsatellites in DNA sequences. Microsatellites are copies of
simple di, tri, tetra, and pentanucleotides which lie adjacent to each
other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite
repeat of tetranucleotide ACGT.


demo Frequency of nucleotides and oligonucleotides

This minitool will count number of ocurrences of each oligonucleotide with
length between 1 and 8 within sequence. Counting may be performed in one
or in blth strands.  

demo PCR amplification

Simulation of PCR amplification. Allows one mismatch between primer and
tenplate

demo Protein sequence properties

The following may be computed: Aminoacid composition, Molecular weight,
Molar absorption coefficient, Protein isoelectric point and Charge. It
also allows geting a colored sequence based in nature of each aminoacid.

demo Protein to DNA reverse translation

Enter a protein sequence and obtain its reverse translation. Useful in
design of degenerate oligonucleotides. All genetic codes are available.


demo Random sequences
A tool to generate random DNA or protein sequences. It allows to shuffle a
sequence, generate a random sequence by using frequencies in a sample
sequences, or to generate random sequences by providing frequencies of
nucleotides or aminoacids.

Reader
This minitool reads fasta and gff files and instantiate sequence objects.

demo Reduced alphabets for proteins
Displays aminoacids by grouping them in classes, so that reduced alphabets
are generated. In the coloured sequence, grouped aminoacids will show the
same colour.   Reduced protein sequence may be also displayed.
Additionally, each aminoacid may be displayed with a distinct colour
(without applying reductions).

demo Restriction enzyme digest of DNA

Restriction digestion of DNA sequences with endonucleases. Allows
restriction of one or more sequences, and also the comparison of
restriction patterns. All commercially available restriction enzymes are
included in the script.


demo Alignment of two DNA, RNA or protein sequences

Alignment of two DNA, RNA or protein sequences. The alignment method is the
Smith-Waterman alignment method is used. More info in the script. 

demo DNA sequence manipulation/properties

The sequence is manipulate to remove non-coding characters, to get reverse
and complement strands, to obtain both strands, to calculate G+C
content and nucleotide composition, or may be converted to RNA.

demo GC-, AT-, KETO- and oligo-skews generator

Genomes and sequences are not a random sequence of bases, and GC-, AT-,
KETO- and oligo-skews allows to visualize the non-constant distribution of
nucleotides and oligonucleotides along sequences.



demo Formula functions
A set of functions for useful formulas