BioPHP - Microsatellite Repeats Finder
Original code submitted by josebaCode bellow is covered by GNU GPL v2 license.
Description
Last change: 2012/04/26 11:13 | Recent Changes | Original descriptionFinds microsatellites in DNA sequences. Microsatellites are copies of simple di, tri, tetra, and pentanucleotides which lie adjacent to each other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite repeat of tetranucleotide ACGT.